Studietaak 5: Computer-tools voor het werken met DNA in het lab

5.1 Restrictiesite-analyse

Het zoeken naar herkenningsplaatsen voor restrictie-enzymen – restrictiesites – in een DNA-sequentie is belangrijk bij het ontwerpen van (sub)kloneringsstrategieën, maar bijvoorbeeld ook binnen de DNA-diagnostiek: veel bekende mutaties kunnen worden aangetoond via het verdwijnen of juist verschijnen van een restrictiesite op de plek van de mutatie. Dit aspect van restrictiesite-analyse komt terug in het minor-onderdeel 'DNA-diagnostiek' in kwartiel 4. 

Enkele nuttige sites op het gebied van restrictie-enzymen en restrictiesite-analyse:

Diversen:

Fragment Size Calculator
De gebruiker voert de opgemeten migratie-afstanden van de bandjes op haar/zijn gel in (= afstand slotje-bandje). In de vakjes 1-5 vul je de migratie-afstanden vanaf de slotjes van vijf bandjes van je molecuulgewicht-standaard (bv. lambda-DNA x HindIII) in, in combinatie met de bijbehorende groottes. Voor een bandje uit je monster, met onbekende grootte, vul je de migratie-afstand in in het vakje bij 'Unknown fragment position'. Het programma rekent vervolgens de lengte van het onbekende bandje uit. Helaas kan dit maar voor 1 onbekend bandje tegelijk, waarbij je elke keer weer de size-marker bandjes moet invullen. Bovendien kun je niet zien of de semi-log grafiek die hier achter zit wel door alle punten een nette rechte lijn geeft.

Determination of Molecular Weight  
Vergelijkbare
tool als hierboven. Werkt een beetje anders: je kiest de door jou gebruikte marker via een drop-down menu en vult vervolgens de bij de verschillende bandjes van de marker behorende migratie-afstanden in.

REBASE
De homepage (gehost door New England BioLabs) vam restrictie-enzymen-database REBASE heeft ook haar eigen homepage. 

JustBio EnzFinder
Ook de REBASE resrictie-enzymen-database, maar dan met een andere zoekinterface en andere presentatie van de resultaten. S

New England BioLabs Enzyme Finder  
U
se this tool to select restriction enzymes by name, sequence, overhang, or type. In search results, enzymes supplied by New England BioLabs (NEB) are listed first and displayed as links.

New England BioLabs Double Digest Finder  
Voor als je met twee restrictie-enzymen wilt knippen en je wilt hiervoor de beste NEB-buffer selecteren.

CloneIt! Online
An online program finding sub-cloning strategies, in-frame deletions and frameshifts using restriction enzymes and DNA polymerases.
Volg de link naar het ‘Example’ om uit te vinden wat dit programma doet (Deze link werkt momenteel helaas niet). In het kort: Voer een plasmide-sequentie in in het vector-venster en een in het insert-venster. Stel een aantal voorwaarden aan de subklonering en laat het programma de mogelijkheden uitzoeken. Het programma analyseert zelf de bij ‘INSERT’ ingevoerde sequentie en leidt daaruit de te subkloneren sequentie af (cloning box).
CloneIt! Homepage
Met uitleg over de mogelijkheden van het programma en de mogelijkheid om een eigen versie te downloaden. Deze link werkt momenteel helaas niet

Restrictiesite-analyse:

Mijn favoriet: New England BioLabs NEBcutter

Nog twee programma's:
JustBio Cutter
(eenvoudig)
Restriction Maps
(onderdeel van de Molecular Toolkit)

 

Opdracht 1: Restrictiesite-analyse van constructen

Uitwerken in groepjes
Deadline inleveren uitwerkingen:
O
p papier meenemen naar de les van vrijdag 3 april

Onderzoekster Lisa Sue heeft een BamHI-insert in de Escherichia coli plasmidevector pTZ geligeerd. Hiervoor heeft ze de BamHI-site in de polylinker van pTZ gebruikt. De insert (waarvan je straks zelf moet uitzoeken om welk DNA het gaat) kan in twee oriëntaties in de vector terecht zijn gekomen. Lisa wil voor de diverse gevonden kloons de oriëntatie van de inserts bepalen. Ze wil dit doen door de plasmide-DNA’s van de verschillende kloons te knippen met een restrictie-enzym dat verschillende fragmenten oplevert voor de twee oriëntaties. De beste keuze hierbij is een restrictie-enzym dat eenmaal buiten de insert knipt (dus in het vector-deel) en eenmaal in de insert (en dan niet in de buurt van het midden van de insert). WAAROM IS DIT DE BESTE KEUZE? TEKEN VOOR JEZELF.

De DNA-sequenties van zowel vector als insert zijn bekend. Hierdoor is Lisa in staat geweest om de DNA-sequenties van de bij deze ligatie ontstane constructen te ‘voorspellen’. Ze heeft de twee mogelijke constructen de aanduidingen pTZBam en pTZBamR gegeven. Hieronder vind je de sequenties van beide constructen:

pTZBam:

CCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCCGGCACCGCAGCTCC
CGTAGATCGCGCTGGGCCCTGAGGGCGTCGAAATGTACGCCCCGCAAAAACAGACAGAAGTCCTTTGGGGTCAGGGTATCGTCGTGTCCCCAGAAGCGCACGCGTATGCAGTTTAGGGTCAGCAGCATGTGAAGGATGTTAAGGCTGTCCGAGAGACACGCCAGCGTGCATCTCTCAAAGTAGTGTTTGTAACGGAATTT
GTTGTAGATGCGCGACCCCCGCCCCAGCGACGTGTCGCATGCCGACGCGTCACAGCGCCCCTTGAACCGGCGACACAGCAGGTTTGTGACCTGGGAGAACTGCGCGGGCCACTGGCCGCAGGAACTGACCACGTGATTAAGGAGCATGGGCGTAAAGACGGGCTCCGAGCGCGCCCCGGAGCCGTCCATGTAAATCAGTA 
GCTCCCCCTTGCGGAGGGTGCGCACCCGTCCCAGGGACTGGTACACGGACACCATGTCCGGTCCGTAGTTCATGGGTTTCACGTAGGCGAACATGCCATCAAAGTGCAGGGGATCGAAGCTGAGGCCCACGGTTACGACCGTCGTGTATATAACCACGCGGTATTGGCCCCACGTGGTCACGTCCCCGAGGGGGGTGAGC
GAGTGAAGCAACAGCACGCGGTCCGTAAACTGACGGCAGAACCGGGCCACGATCTCCGCGAAGGAGACCGTCGACGAAAAAATGCAGATGTTATCGCCCCCGCCAAGGCGCGCTTCCAGCTCCCCAAAGAACGTGGCCCCCCGGGCCTCCGGAGAGGCGTCCGGAGACGGGCCGCTCGGCGGCCCGGGCGGGCGCAGGGC 
AGCCTGCAGGAGCTCGGTCCCCAGACGCGGGAGAAACAGGCACCGGCGCGCCGAAAACCCGGGCATGGCGTACTCGCCGACCACCACATGCACGTTTTTTTCGCCCCGGAGACCGCACAGGAAGTCCACCAACTGCGCGTTGGCGGTTGCGTCCATGGCGATGATCCGAGGACAGATGCGCAGCAGGCGTAGCATTAACG
CATCCACGCGGCCCAGTTGCTGCATCGTTGGCGAATAGAGCTGGCCCAGCGTCGACATAACCTCGTCCAGAACGAGGACGTCGTAGTTGTTCAGAAGGTTGGGGCCCACGCGATGAAGGCTTTCCACCTGGACGATAAGTCGGTGGAAGGGGCGGTCGTTCATAATGTAATTGGTGGATGAGAAGTAGGTGACAAAGTCG 
ACCAGGCCTGACTCAGCGAACCGCGTCGCTAGGGTCTGGGTAAAACTCCGACGACAGGAGACGACGAGCACACTCGTGTCCGGAGAGTGGATCGCTTCCCGCAGCCAGCGGATCAGCGCGGTAGTTTTTCCCGACCCCATTGGCGCGCGGACCACAGTCACGCACCTGGCCGTCGGGGCGCTCGCGTTGGGGAAGGTGAC
GGGTCCGTGCTGCTGCCGCTCGATCGTTGTTTTCGGGTGAACCCGGGGCACCCATTCGGCCAAATCCCCCCCGTACAACATCCGCGCTAGCGATACGCTCGACGTGTACTGTTCGCACTCGTCGTCCCCAATGGGACGCCCGGCCCCCAGAGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCCCTATAGTGAG 
TCGTATTAAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGA
ATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG 
TAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGG
GAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGA 
GCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAA
AAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCA 
GTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCT
GCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAA 
AGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAA
TACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC 
GCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAG
CGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGCATCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATG 
GTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCG
AATTTTAACAAAATATTAACAAAATATTAACGTTTACAATTT   

pTZBamR:

CCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTGGGGGCCGGGCG 
TCCCATTGGGGACGACGAGTGCGAACAGTACACGTCGAGCGTATCGCTAGCGCGGATGTTGTACGGGGGGGATTTGGCCGAATGGGTGCCCCGGGTTCACCCGAAAACAACGATCGAGCGGCAGCAGCACGGACCCGTCACCTTCCCCAACGCGAGCGCCCCGACGGCCAGGTGCGTGACTGTGGTCCGCGCGCCAATGG
GGTCGGGAAAAACTACCGCGCTGATCCGCTGGCTGCGGGAAGCGATCCACTCTCCGGACACGAGTGTGCTCGTCGTCTCCTGTCGTCGGAGTTTTACCCAGACCCTAGCGACGCGGTTCGCTGAGTCAGGCCTGGTCGACTTTGTCACCTACTTCTCATCCACCAATTACATTATGAACGACCGCCCCTTCCACCGACTT 
ATCGTCCAGGTGGAAAGCCTTCATCGCGTGGGCCCCAACCTTCTGAACAACTACGACGTCCTCGTTCTGGACGAGGTTATGTCGACGCTGGGCCAGCTCTATTCGCCAACGATGCAGCAACTGGGCCGCGTGGATGCGTTAATGCTACGCCTGCTGCGCATCTGTCCTCGGATCATCGCCATGGACGCAACCGCCAACGC
GCAGTTGGTGGACTTCCTGTGCGGTCTCCGGGGCGAAAAAAACGTGCATGTGGTGGTCGGCGAGTACGCCATGCCCGGGTTTTCGGCGCGCCGGTGCCTGTTTCTCCCGCGTCTGGGGACCGAGCTCCTGCAGGCTGCCCTGCGCCCGCCCGGGCCGCCGAGCGGCCCGTCTCCGGACGCCTCTCCGGAGGCCCGGGGGG 
CCACGTTCTTTGGGGAGCTGGAAGCGCGCCTTGGCGGGGGCGATAACATCTGCATTTTTTCGTCGACGGTCTCCTTCGCGGAGATCGTGGCCCGGTTCTGCCGTCAGTTTACGGACCGCGTGCTGTTGCTTCACTCGCTCACCCCCCTCGGGGACGTGACCACGTGGGGCCAATACCGCGTGGTTATATACACGACGGTC
GTAACCGTGGGCCTCAGCTTCGATCCCCTGCACTTTGATGGCATGTTCGCCTACGTGAAACCCATGAACTACGGACCGGACATGGTGTCCGTGTACCAGTCCCTGGGACGGGTGCGCACCCTCCGCAAGGGGGAGCTACTGATTTACATGGACGGCTCCGGGGCGCGCTCGGAGCCCGTCTTTACGCCCATGCTCCTTAA 
TCACGTGGTCAGTTCCTGCGGCCAGTGGCCCGCGCAGTTCTCCCAGGTCACAAACCTGCTGTGTCGCCGGTTCAAGGGGCGCTGTGACGCGTCGGCATGCGACACGTCGCTGGGGCGGGGGTCGCGCATCTACAACAAATTCCGTTACAAACACTACTTTGAGAGATGCACGCTGGCGTGTCTCTCGGACAGCCTTAACA
TCCTTCACATGCTGCTGACCCTAAACTGCATACGCGTGCGCTTCTGGGGACACGACGATACCCTGACCCCAAAGGACTTCTGTCTGTTTTTGCGGGGCGTACATTTCGACGCCCTCAGGGCCCAGCGCGATCTACGGGAGCTGCGGTGCCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCCCTATAGTGAG 
TCGTATTAAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGA
ATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG 
TAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGG
GAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGA 
GCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAA
AAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCA 
GTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCT
GCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAA 
AGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAA
TACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC 
GCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAG
CGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGCATCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATG 
GTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCG
AATTTTAACAAAATATTAACAAAATATTAACGTTTACAATTT

Vragen:

1. Als je beide constructen met BamHI knipt, welke fragmenten levert dit dan op (hoeveel en hoe groot)? Welk fragment is afkomstig van de vector en welk fragment van de insert? Hoe weet je dat?

2. Welk(e) van de onderstaande restrictie-enzymen is/zijn bruikbaar voor de hierboven beschreven oriëntatie-analyse? M.a.w.: met welk(e) van onderstaande restrictie-enzym(en) kan Lisa de plasdmide DNA's die ze uit haar kloons isoleert knippen om te achterhalen of een kloon pTZBam of pTZBamR bevat?  Geef voor het enzym van je keuze – of voor één van de enzymen als er meerdere bruikbaar zijn – de restrictiepatronen (= de grootte van de ontstane fragmenten) die ontstaan bij het knippen van respectievelijk pTZBam en pTZBamR. Kies uit: BspMI, StuI, SphI, BamHI, XmnI, Bsu36I, Alw44I, BbrPI, SstI / SacI (twee namen voor hetzelfde enzym).

3. Met welke twee restrictie-enzymen kan de insert ‘asymmetrisch’ uit pTZBam of pTZBamR worden geknipt? Met asymmetrisch wordt hier bedoeld dat er twee verschillende uiteinden ontstaan, zodat de insert ‘geforceerd’ in een andere vector kan worden gezet, d.w.z. met maar één mogelijke oriëntatie.

4. Wat is de functie van het grootste ORF van de gebruikte vector? Deze vraag gaat dus NIET het ORF dat hoort bij de insert!

5. Welk gen bevindt zich in de insert (= het in pTZ gekloneerde BamHI-fragment) en uit welk 'organisme' is dit afkomstig? Is dit het gehele gen of slechts een deel van het gen? Verklaar de verschillen in lengtes tussen de eiwitten gecodeerd door de inserts van pTZBam, pTZBamR en het daadwerkelijke eiwit uit het 'organisme'. 
Tip: Kijk om te beginnen aan de beantwoording van deze vragen eens naar het aantal aminozuren behorend bij de ORFs die NEBcutter voorspelt in beide constructen. Wat valt je op??? Als je nadenkt over en uitzoekt hoe dit kan, kom je 'vanzelf' achter de antwoorden op deze vragen. 

NB1: We werken in deze opdracht alleen met de meest gebruikte categorie van restrictie-enzymen: de ‘zes-knippers’ (dus enzymen met herkenningssequenties van 6 basen of meer). NEBcutter gaan hier standaard van uit en staan ingesteld op het zoeken naar sites voor zes-knippers en hoger.

NB2: Denk bij het invoeren van de sequenties in de NEBcutter eraan dat het hier gaat om de sequenties van circulaire moleculen!

Te gebruiken tools:

  • NEBcutter 
    Kijk goed wat dit programma allemaal kan en hoe je het moet instellen om de antwoorden te krijgen die jij zoekt! 
    Belangrijke tip: Het programma staat standaard ingesteld op het zoeken naar unieke sites, maar kan ook worden ingesteld op het zoeken naar sites van enzymen die vaker dan 1 keer knippen in een sequentie.

Voor de beantwoording van vraag 5 kunnen van pas komen:

  • NCBI ORF Finder  
    • Hiermee kun je mooi zien waar de BamHI-sites liggen ten opzichte van de aminozuurvolgordes van het insert-ORF in pTZBam en pTZBamR
  • NCBI BLAST 2 sequences (DNA) 
    • Hiermee kun je de sequenties van pTZBam en pTZBamR met elkaar vergelijken
  • NCBI BLAST 2 sequences (Protein) 
    • Hiermee kun je de sequenties van de insert-ORFs van pTZBam en pTZBamR met elkaar vergelijken
  • ClustalW (Protein; Let op: werkt alleen met sequenties in Fasta format: deze gewoon onder elkaar in het zoekvenster plakken zonder lege regels 
    • Hiermee kun je de aminozuursequenties behorend bij de insert-ORFs van pTZBam en pTZBamR met elkaar vergelijken en met de aminozuurvolgorde van het eiwit, zoals dit voorkomt in het 'organisme' waaruit het BamHI-fragment is gehaald

MSA tussen de eiwitsequenties van de ORFs in pTZBam, pTZBamR en van het hele virus-eiwit