5.3 PCR-primerontwerp

Het aandeel van de computer bij PCR ligt vooral bij het ontwerp van PCR-primers: de cruciaalste stap voor een succesvolle PCR. Bij het ontwerp van goede PCR-primers geldt een aantal criteria. Hierover is informatie te vinden op diverse websites. Ik heb een soort gemiddelde gemaakt van criteria die ik in verschillende boeken en op diverse sites heb gevonden. Maak hiervan gebruik als je zelf primers moet ontwerpen of de kwaliteit van bestaande primers wilt checken (5.3.1). Primer-ontwerp-programmas houden met alle of zoveel mogelijk van deze criteria rekening; in hoeverre ze dat doen is afhankelijk van het betreffende programma. Verder is het zo dat bij de meeste programmas de gebruiker zelf deze criteria kan variren.

In 5.3.2 komt een aantal online beschikbare programma's aan de orde om de kwaliteit van PCR-primers te checken (= door te checken of ze aan de diverse criteria voor goede PCR-primers voldoen). Daarnaast worden in 5.3.2 ook enkele online beschikbare programma's voor het zelf ontwerpen van primers gepresenteerd.

Dit onderdeel wordt afgesloten met een aantal opdrachten waarin je de tools uit 5.3.2 toepast.

Meer aandacht voor het ontwerpen van goede PCR-primers voor het aantonen van genen en mutaties komt er in het minor-onderdeel 'DNA-diagnostiek' in kwartiel 4.

5.3.1 Criteria voor goede PCR-primers:

1. Goede PCR-primers zijn 17-30 nucleotiden lang
Zie voor de achtergrond hiervan het boek van Brown
paragraaf 9.2.1!

2. Goede PCR-primers bestaan voor 35-65% uit Gs en Cs
Als je binnen die grenzen blijft, krijg je een Tm die zo tussen de 55 en de 80 graden celcius ligt (bij een lengte van 17-30 nucleotiden). De bovengrens van 65% is bovendien belangrijk, omdat je boven de 65% GC erg veel kans loopt op stabiele interne basenparing binnen de primers (hairpins).

3. Goede PCR-primers hebben een berekende smelttemperatuur (Tm) van 55-80C

De bijbehorende annealingstemperatuur in de PCR Ta = Tm - 1-2C volgens Brown, maar het boek Moleculaire Diagnostiek adviseert om voor de annealing 5 graden onder de Tm te gaan zitten, dus Ta = Tm - 5C. In de praktijk is het toch een kwestie van uitproberen wat bij een nieuw PCR-primerpaar de ideale Ta is. Je zoekt die Ta, waarbij er zoveel mogelijk specifiek PCR-product ontstaat, zonder dat er bijproducten ontstaan (zie Figuur 1 en 2).

Figuur 1: Hier is steeds dezelfde PCR-reactie uitgevoerd, waarbij steeds de annealingstemperatuur is gevarieerd. In dit voorbeeld waarin er bij de lagere annealingstemperaturen geen (detecteerbare) bijbproducten onstaan, maar waarbij het duidelijk is dat er bij een te hoge annealingstemperatuur geen PCR-product meer gevormd wordt. De optimale annealingstemperatuur ligt bij dit voorbeeld bij 57,6-58,9C.

Figuur 2: Ook hier is steeds dezelfde PCR-reactie uitgevoerd (een andere dan in Figuur 1) met variatie van de annealingstemperatuur (voor twee verschillende hittestabiele DNA-polymerases). Hier zien we dat er bij te lage annealingstemperaturen niet-specifieke bijproducten ontstaan. Als men hier boven de 60C was gegaan, hadden we op een gegeven moment (net als in Figuur 1) gezien dat er helemaal geen PCR-product meer werd gevormd. De optimale annealingstemperatuur ligt bij dit voorbeeld bij 58-60C.

Het allermooiste is het om met de Ta ergens tussen de 72 en 80C uit te komen, omdat een cyclus dan sneller gaat: afkoelen van 96C (de denaturatie-temperatuur) naar bv. 75C als annealing-temperatuur en dan verder afkoelen naar 72C voor de elongatie-stap gaat sneller dan afkoelen van 96C naar bv. 50C als annealing-temperatuur en dan weer verhitten naar 72C voor de elongatie-stap.

4.
Goede PCR-primers eindigen (3) bij voorkeur op G of C of CG of GC, maar ook niet meer dan twee G/C's
Doordat de G-C-basenparing steviger is (3 H-bruggen) dan de A-T-basenparing (2 H-bruggen) voorkomt de aanwezigheid van een of twee G's of C's aan het uiteinde dat dit gaat flapperen en dit zorgt uiteindelijk voor een grotere efficintie van de priming (= het daadwerkelijk verlengd worden van de primer door het polymerase).
Bij teveel Gs of Cs kan er niet-specifieke annealing aan GC-rijke sequenties (mispriming) optreden.

5. 3-uiteinden van van goede linker- en rechter primers mogen bij voorkeur niet complementair zijn (maximaal 3 basen)
Anders onstaan er vooral primer-dimeren tijdens de PCR-reactie.

6. Goede primers moeten zo min mogelijk (maximaal 3 basen) complementair met zichzelf zijn (self-complementary)
Anders ontstaan er secundaire structuren, zoals hairpins, of vormt de primer liever dimeren met 'collega-primers'  dan dat hij gaat annealen met de doelsequentie (target); zie figuur 3.

NB: Complementariteit tussen de primers onderling (punt 5) en van primers met zichzelf (punt 6) is lang niet altijd te voorkomen; de vuistregel is daarom bij voorkeur maximaal 3 basen complementair!

7. Goede PCR-primers schelen zo min mogelijk (vuistregel: maximaal 5C) in Tm
Als twee primers voor een PCR-reactie teveel van elkaar verschillen in Tm wordt het onmogelijk om een annealingtemperatuur te vinden waarbij beide primers specifiek binden. 
Ga dat maar eens voor jezelf na door te bedenken wat er zou gebeuren als je een linker primer zou gebruiken met een berekende Tm van 50 graden en een rechter primer met een berekende Tm van 70 graden. Beredeneer wat er qua annealing met elke primer zou gebeuren bij 48 graden, bij 58 graden en bij 68 graden.  
Als je zelf twee primers hebt ontworpen die meer dan 5C van Tm verschillen, kun je dit meestal eenvoudig aanpassen door de primer met de laagste Tm een of twee nucleotiden langer te maken aan de 5'- of de 3'-kant.
Als temperatuur voor de annealingfase van de PCR-cyclus (Ta) kies je een temperatuur die 1 tot 2C (volgens Brown) onder de laagste van de twee Tm's ligt. In de praktijk wordt ook nogal eens gekozen voor een Ta van 5C onder de laagste Tm.

Hairpin
Dimer

        Figuur 3: Plaatjes van primers die respectievelijk een hairpin en een dimeer met zichzelf kunnen vormen (zie punt 6)


5.3.2 Primers ontwerpen en checken

Veel van de onderstaande programma's zijn niet alleen bedoeld voor het ontwerpen c.q. checken van PCR-primers, maar ook voor oligonucleotiden die gebruikt worden voor sequencing of hybridisatie. Ik gebruik meestal de term 'primers', omdat de nadruk in dit stuk ligt op PCR-primers, maar meestal kun je voor die term ook de algemenere term 'oligonucleotiden' (kortweg 'oligo's') lezen.

Analyse van reeds ontworpen primers:

Bekijk deze tools en gebruik de volgens jou handigste bij het checken van primers. Dit kunnen bijvoorbeeld primers zijn die je uit de literatuur hebt gehaald of primers die je zelf met de hand hebt ontworpen. Dai laatstet komt nogal eens voor bij het ontwerpen van primers in de recombinant-DNA-technologie, waar de plaats van primers rondom een te kloneren gen behoorlijk vast ligt.

IDT BioTools OligoAnalyzer 3.0
Analyseert reeds ontworpen losse primers of primer-paren uitgebreid op algemene kenmerken en de belangrijke criteria voor goede primers; biedt tevens een link naar de BLAST-site van NCBI aan om de 'uniekheid' van ontworpen primers te kunnen checken (meer hierover hieronder).

PREMIER Biosoft NetPrimer  
Registratie vereist.
Opstarten via de knop Launch NetPrimer.
Analyseert reeds ontworpen losse primers of primer-paren uitgebreid op algemene kenmerken en de belangrijke criteria voor goede primers.
Maakt gebruik van een applet en kan problemen opleveren bij trage Internet-verbindingen. 

Oligo Calculator
Berekent enkele kenmerken (Tm, %GC e.d.) van reeds ontworpen losse primers.

CyberGene EazyPrimer
Analyseert bestaande primers op aanwezigheid van secundaire structuur als gevolg van zelfcomplementariteit en berekent enkele kenmerken van reeds ontworpen losse primers.

 

Programma's voor primer-ontwerp:

Het volgens mij beste gratis online programma: Primer3 (als deze link niet meer werkt: Primer 3 is op diverse sites beschikbaar; gewoon Googelen met primer 3)

Ontwerp van PCR-primers, waarbij ook de reactie-omstandigheden worden meegenomen. Deze zijn door de gebruiker in te stellen. Verder kunnen heel veel parameters rond de primers zelf door de gebruiker worden bepaald, inclusief parameters betreffende primer-dimeer-vorming, secundaire structuur etc. Ook kan vermeden worden dat primers in bekende repeats liggen. Als een primer in een repeat ligt, is een primer immers niet uniek meer. Het programma doorzoekt de ingevoerde sequentie op de aanwezigheid van deze repeats (alleen mogelijk voor humane en knaagdier-repeats) en als het een of meer bekende repeats vindt, sluit het deze uit als locatie voor primers. De gebieden waarin het programma naar primers moet zoeken, kunnen worden aangegeven. Dit alles maakt Primer 3 de meest uitgebreide primer-ontwerp-tool. Het programma wordt gelukkig niet te ingewikkeld doordat alle parameters een standaardwaarde (default) hebben en doordat er een goede help-functie is.

Ook beschikbaar via JustBio: Primer3; wel eerst inloggen (bv. met inlognaam arzeecue, wacthwoord arziekjoe)

Variant van Primer3 bij een commercile firma: PrimerQuest
Niet alleen ontwerp van PCR-primers, maar ook van oligo's voor real-time PCR (= PCR-primers en probe), sequencing en probing. PrimerQuest heeft een zeer overzichtelijk interface. Het handige van PrimerQuest is dat er drie varianten zijn: BASIC, STANDARD en ADVANCED.  

Nieuw programma: CyberGene GeneWalker (op deze pagina vind je een link naar de 'evaluation release')
Ik heb helaas nog geen tijd gehad om dit programma te testen, dus dat mag je zelf doen in de opdrachten.


Studietaak 5, Opdracht 3: Primers checken en ontwerpen

Uitwerken in groepjes
Deadline inleveren uitwerkingen:
A en B op papier meenemen naar de les van vrijdag 3 april, C opsturen per mail vr de les van dinsdag 7 april.

A. Invloed van de lengte van PCR-primers op de specificiteit van het resultaat
Ooit heb je geleerd dat primers met een lengte van 17 nt statistisch gezien een uniek PCR-product zouden moeten opleveren bij het PCR-en van een stuk humaan DNA (zie Brown paragraaf 9.2.1). 
Als je de berekening zoals Brown die laat zien loslaat op kleinere genomen, zoals die van bacterin, kom je natuurlijk op een lager getal uit. Voor het genoom van Escherichia coli geldt bijvoorbeeld  
geldt dat primers van 12 nt statistisch gezien een uniek PCR-product zouden opleveren.

Hieronder zie je de DNA-sequentie van het ponA1-gen van Mycobacterium tubercolosis. Ook zie je dat ik al primers van 17 nt lang bedacht heb om dit gen te amplificeren. Ga zelf na of je snapt 
hoe ik deze primers uit de sequentie heb afgeleid.
>ponA1 Mycobacterium tuberculosis
GTGGTGATCCTGTTGCCGATGGTCACCTTCACGATGGCCTACCTGATCGTCGACGTTCCCAAGCCAGGTG
ACATCCGTACCAACCAGGTCTCCACGATCCTTGCCAGCGACGGCTCGGAAATCGCCAAAATTGTTCCGCC
CGAAGGTAATCGGGTCGACGTCAACCTCAGCCAGGTGCCGATGCATGTGCGCCAGGCGGTGATTGCGGCC
GAAGACCGCAATTTCTATTCGAATCCGGGATTCTCGTTCACCGGCTTCGCGCGGGCAGTCAAGAACAACC
TGTTCGGCGGCGATCTGCAGGGCGGATCGACGATTACCCAGCAGTACGTCAAGAACGCGCTGGTCGGTTC
CGCACAGCACGGGTGGAGCGGTCTGATGCGCAAGGCGAAAGAATTGGTCATCGCGACGAAGATGTCGGGG
GAGTGGTCTAAAGACGATGTGCTGCAGGCGTATCTGAACATCATCTACTTCGGCCGGGGCGCCTACGGCA
TTTCGGCGGCGTCCAAGGCTTATTTCGACAAGCCCGTCGAGCAGCTGACCGTTGCCGAAGGGGCGTTGTT
GGCAGCGCTGATTCGGCGGCCTTCGACGCTGGACCCGGCGGTCGACCCCGAAGGGGCCCATGCCCGCTGG
AATTGGGTACTCGACGGCATGGTGGAAACCAAGGCTCTCTCGCCGAATGACCGTGCGGCGCAGGTGTTTC
CCGAGACAGTGCCGCCCGATCTGGCCCGGGCAGAGAATCAGACCAAAGGACCCAACGGGCTGATCGAGCG
GCAGGTGACAAGGGAGTTGCTCGAGCTGTTCAACATCGACGAGCAGACCCTCAACACCCAGGGGCTGGTG
GTCACCACCACGATTGATCCGCAGGCCCAACGGGCGGCGGAGAAGGCGGTTGCGAAATACCTGGACGGGC
AGGACCCCGACATGCGTGCCGCCGTGGTTTCCATCGACCCGCACAACGGGGCGGTGCGTGCGTACTACGG
TGGCGACAATGCCAATGGCTTTGACTTCGCTCAAGCGGGATTGCAGACTGGATCGTCGTTTAAGGTGTTT
GCTCTGGTGGCCGCCCTTGAGCAGGGGATCGGCCTGGGCTACCAGGTAGACAGCTCTCCGTTGACGGTCG
ACGGCATCAAGATCACCAACGTCGAGGGCGAGGGTTGCGGGACGTGCAACATCGCCGAGGCGCTCAAAAT
GTCGCTGAACACCTCCTACTACCGGCTGATGCTCAAGCTCAACGGCGGCCCACAGGCTGTGGCCGATGCC
GCGCACCAAGCCGGCATTGCCTCCAGCTTCCCGGGCGTTGCGCACACGCTGTCCGAAGATGGCAAGGGTG
GACCGCCCAACAACGGGATCGTGTTGGGCCAGTACCAAACCCGGGTGATCGACATGGCATCGGCGTATGC
CACGTTGGCCGCGTCCGGTATCTACCACCCGCCGCATTTCGTACAGAAGGTGGTCAGTGCCAACGGCCAG
GTCCTCTTCGACGCCAGCACCGCGGACAACACCGGCGATCAGCGCATCCCCAAGGCGGTAGCCGACAACG
TGACTGCGGCGATGGAGCCGATCGCAGGTTATTCGCGTGGCCACAACCTAGCGGGTGGGCGGGATTCGGC
GGCCAAGACCGGCACTACGCAATTTGGTGACACCACCGCGAACAAAGACGCCTGGATGGTCGGGTACACG
CCGTCGTTGTCTACGGCTGTGTGGGTGGGCACCGTCAAGGGTGACGAGCCACTGGTAACCGCTTCGGGTG
CAGCGATTTACGGCTCGGGCCTGCCGTCGGACATCTGGAAGGCAACCATGGACGGCGCCTTGAAGGGCAC
GTCGAACGAGACTTTCCCCAAACCGACCGAGGTCGGTGGTTATGCCGGTGTGCCGCCGCCGCCGCCGCCG
CCGGAGGTACCACCTTCGGAGACCGTCATCCAGCCCACGGTCGAAATTGCGCCGGGGATTACCATCCCGA
TCGGTCCCCCGACCACCATTACCCTGGCGCCACCGCCCCCGGCCCCGCCCGCTGCGACTCCCACGCCGCC
GCCGTGA

Primers:
L: GTGGTGATCCTGTTGCC
R: TCACGGCGGCGGCGTGG
Ga nu naar http://www.in-silico.com/ > PCR amplification > Mycobacterium 
Kopieer de primersequenties naar het invoerscherm en kies de juiste Mycobacterium 
(M. tuberculosis H37Rv).
Bekijk het virtuele PCR-product. Kijk vervolgens wat er gebeurt als je beide primers steeds korter maakt vanaf de 3'-kant (minimumlengte is 10 nt!). 
Te beantwoorden vragen:
1. Blijft het een uniek PCR-product? 
2. Bij welke lengtes is er geen uniek PCR-product meer en hoe kan dat?
B. BM-primers checken

Zijn de primers die we op school voor allerlei PCR's gebruiken wel goed? Met andere woorden: voldoen ze aan de voorwaarden voor goede primers? Bekijk zelf de kwaliteit van een aantal van de primer-paren hieronder met behulp van het programma NetPrimer. Kies zelf een primerset uit die je wilt analyseren.

Primerset voor identificatie van bacterie X:

MPP1-L GAAGCTTATGGTACAGGTTGG
MPP1-R ATTACCATCCTTGTTGTAAGG

NB: Welke bacterie met deze primerset kan worden gedetecteerd, gaan we straks nog achterhalen!

Primerset voor amplificatie Factor V Leiden gebied (dus humaan): 

APC M3 CTTGAAGGAAATGCCCCATTA
APC M5 TGCCCAGTGCTTAACAAGACCA

Programma:

IDT BioTools OligoAnalyzer 3.0

Het analyseren van de primersets:

  1. Plak sequentie linker primer in en klik op 'ANALYZE'.
  2. Noteer: lengte, GC-gehalte, Tm.
  3. Klik op 'HAIRPIN' en vervolgens op 'SUBMIT'.
  4. Noteer: aantal hairpins en bijbehorende Tm.
  5. Klik op 'SELF-DIMER'.
  6. Noteer het aantal mogelijke homo-dimeren (niet schrikken!) en het hoogste aantal complementaire basen.
  7. Klik op 'HETERO-DIMER'.
  8. Plak de sequentie van de rechter primer in en klik op 'CALCULATE'.
  9. Noteer het aantal mogelijke hetero-dimeren (niet schrikken!) en het hoogste aantal complementaire basen.
  10. Vervang de sequentie van de linker primer door die van de rechterprimer en herhaal hiervoor stap 1-6.

Leg deze informatie naast de volgende criteria voor goede PCR-primers en noteer of de door jou geanalyseerde primers hieraan voldoen of niet:

1. Goede PCR-primers zijn 17-30 nucleotiden lang
2. Goede PCR-primers bestaan voor 35-65% uit Gs en Cs
3. Goede PCR-primers hebben een berekende smelttemperatuur (Tm) van 55-80C. Het allermooiste is het om met de Ta ergens tussen de 72 en 80C (dus Tm daar een paar graden boven) uit te komen, omdat een cyclus dan sneller gaat: afkoelen van 96C (de denaturatie-temperatuur) naar bv. 75C als annealing-temperatuur en dan verder afkoelen naar 72C voor de elongatie-stap gaat sneller dan afkoelen van 96C naar bv. 50C als annealing-temperatuur en dan weer verhitten naar 72C voor de elongatie-stap.

Vanaf criterium 4 gaat het niet meer om eisen, maar om 'voorkeuren'; de hier genoemde kenmerken zijn niet essentieel, maar wel 'verstandig'; advies is om hier als het enigszins mogelijk is aan te voldoen bij het ontwerpen van primers. Aan deze voorkeurs-kenmerken kan echter niet altijd worden voldaan.

4. Goede PCR-primers eindigen (3) bij voorkeur op G of C of CG of GC, maar ook niet meer dan twee G/C's
5. 3-uiteinden van van goede linker- en rechter primers mogen bij voorkeur niet complementair zijn (maximaal 3 basen)
6. Goede primers moeten zo min mogelijk (maximaal 3 basen) complementair met zichzelf zijn (self-complementary)
7. Goede PCR-primers schelen zo min mogelijk (vuistregel: maximaal 5C) in Tm

Zet als uitwerking van dit onderdeel de volgende informatie op een rijtje:

  • Van twee primer-sets je bevindingen, zoals hierboven gevraagd.
  • Wat is jouw oordeel over de kwaliteit van deze twee primer-sets?

C. PCR-primers ontwerpen

We hebben het lactose-operon van Escherichia coli en willen specifiek het lacY-gen, dat codeert voor lactose permease, hieruit isoleren. In plaats van een subklonering via restrictie-enzymen willen we een veel snellere methode gebruiken: een PCR-reactie die precies het lacY-gen amplificeert. Op een vergelijkbare manier zou je ook een specifiek exon uit een eukaryoot gen kunnen amplificeren of bijvoorbeeld een bepaald gen uit het chromosoom van een pathogene bacterie.

Opdracht:
Zoek de locatie van het lacY-gen in de sequentie op m.b.v. de ORF Finder (gebruik de BLAST-functie van ORF Finder om het lacY-gen te identificeren). Ontwerp vervolgens PCR-primers voor de specifieke amplificatie van het lacY-gen. Doe dit met een van de primet-ontwerpprogramma's die hierboven zijn genoemd. Het resultaat van deze opdracht is een Word-file met daarin:

  • Een tabel met:
    • de sequenties van de primers
    • de groottes van de primers
    • het %GC van de primers
    • De Tm's van de primers
  • De onderstaande sequentie met daarin aangegeven de posities van de primers

Voorwaarden aan de primers:

Primergrootte: 17 30; optimum 20
%GC: 35-65; optimum 50
Tm: 55-80 C; optimum 70 C; maximum verschil tussen de primers: 6 C
GC-clamp: 2

Aanwijzingen voor instellen van het gebied waar primers terecht moeten komen bij gebruik van Primer3:
K
an op verschillende manieren, bv. door met rechte haken in de sequentie het gebied aan te geven waar geen primers moeten worden gezocht. Het eenvoudigst is echter om bij Targets aan te geven waar geen primers gezocht moeten worden. Als je daar het gebied van het lacY-gen uitsluit, zoekt het programma alleen in de gebieden voor en achter het lacY-gen. Als je een target wilt uitsluiten, doe je dat door in het vakje achter Targets xxx, yyy in te voeren, waarbij xxx staat voor de nucleotidepositie van de start van het target en yyy voor de lengte (in nt) van het gebied waarin het target ligt. Dit zegt dan tegen het programma dat het vanaf base xxx (= start target) in een gebied van yyy basen (= lengte target) niet naar primers moet zoeken. Dit gaat alleen goed als je ook bij Product size geschikte waardes invoert! De product size moet natuurlijk rond de lengte van het target liggen (in jullie geval dus de grootte van het lacY gen)! Om dit te bereiken, vul je bij Product size bij opt. de lengte van het lacY ORF in en ga je bij min. en bij max. respectievelijk 50 bp onder en boven dat getal zitten.

Sequentie lac operon E. coli:
NB:
Dit is niet de sequentie van het hele lactose-operon van E. coli, maar van het halve operon; dit om de zaak behapbaar te maken.

CTGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGAT
GCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACA
CCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTC
GGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTG
CCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGC
GAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAA
CAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATC
GACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAG
CTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAATAATAACCGGGCAGGCCA
TGTCTGCCCGTATTTCGCGTAAGGAAATCCATTATGTACTATTTAAAAAACACAAACTTTTGGATG
TTCGGTTTATTCTTTTTCTTTTACTTTTTTATCATGGGAGCCTACTTCCCGTTTTTCCCGATTTGG
CTACATGACATCAACCATATCAGCAAAAGTGATACGGGTATTATTTTTGCCGCTATTTCTCTGTTC
TCGCTATTATTCCAACCGCTGTTTGGTCTGCTTTCTGACAAACTCGGGCTGCGCAAATACCTGCTG
TGGATTATTACCGGCATGTTAGTGATGTTTGCGCCGTTCTTTATTTTTATCTTCGGGCCACTGTTA
CAATACAACATTTTAGTAGGATCGATTGTTGGTGGTATTTATCTAGGCTTTTGTTTTAACGCCGGT
GCGCCAGCAGTAGAGGCATTTATTGAGAAAGTCAGCCGTCGCAGTAATTTCGAATTTGGTCGCGCG
CGGATGTTTGGCTGTGTTGGCTGGGCGCTGTGTGCCTCGATTGTCGGCATCATGTTCACCATCAAT
AATCAGTTTGTTTTCTGGCTGGGCTCTGGCTGTGCACTCATCCTCGCCGTTTTACTCTTTTTCGCC
AAAACGGATGCGCCCTCTTCTGCCACGGTTGCCAATGCGGTAGGTGCCAACCATTCGGCATTTAGC
CTTAAGCTGGCACTGGAACTGTTCAGACAGCCAAAACTGTGGTTTTTGTCACTGTATGTTATTGGC
GTTTCCTGCACCTACGATGTTTTTGACCAACAGTTTGCTAATTTCTTTACTTCGTTCTTTGCTACC
GGTGAACAGGGTACGCGGGTATTTGGCTACGTAACGACAATGGGCGAATTACTTAACGCCTCGATT
ATGTTCTTTGCGCCACTGATCATTAATCGCATCGGTGGGAAAAACGCCCTGCTGCTGGCTGGCACT
ATTATGTCTGTACGTATTATTGGCTCATCGTTCGCCACCTCAGCGCTGGAAGTGGTTATTCTGAAA
ACGCTGCATATGTTTGAAGTACCGTTCCTGCTGGTGGGCTGCTTTAAATATATTACCAGCCAGTTT
GAAGTGCGTTTTTCAGCGACGATTTATCTGGTCTGTTTCTGCTTCTTTAAGCAACTGGCGATGATT
TTTATGTCTGTACTGGCGGGCAATATGTATGAAAGCATCGGTTTCCAGGGCGCTTATCTGGTGCTG
GGTCTGGTGGCGCTGGGCTTCACCTTAATTTCCGTGTTCACGCTTAGCGGCCCCGGCCCGCTTTCC
CTGCTGCGTCGTCAGGTGAATGAAGTCGCTTAAGCAATCAATGTCGGATGCGGCGCGACGCTTATC
CGACCAACATATCATAACGGAGTGATCGCATTGAACATGCCAATGACCGAAAGAATAAGAGCAGGC
AAGCTATTTACCGATATGTGCGAAGGCTTACCGGAAAAAAGACTTCGTGGGAAAACGTTAATGTAT
GAGTTTAATCACTCGCATCCATCAGAAGTTGAAAAAAGAGAAAGCCTGATTAAAGAAATGTTTGCC
ACGGTAGGGGAAAACGCCTGGGTAGAACCGCCTGTCTATTTCTCTTACGGTTCCAACATCCATATA
GGCCGCAATTTTTATGCAAATTTCAATTTAACCATTGTCGATGACTACACGGTAACAATCGGTGAT
AACGTACTGATTGCACCCAACGTTACTCTTTCCGTTACGGGACACCCTGTACACCATGAATTGAGA
AAAAACGGCGAGATGTACTCTTTTCCGATAACGATTGGCAATAACGTCTGGATCGGAAGTCATGTG
GTTATTAATCCAGGCGTCACCATCGGGGATAATTCTGTTATTGGCGCGGGTAGTATCGTCACAAAA
GACATTCCACCAAACGTCGTGGCGGCTGGCGTTCCTTGTCGGGTTATTCGCGAAATAAACGACCGG
GATAAGCACTATTATTTCAAAGATTATAAAGTTGAATCGTCAGTTTAAATTATAAAAATTGCCTGA
TACGCTGCGCTTATCAGGCCTACAAGTTCAGCGATCTACATTAGCCGCATCCGGCATGAACAAAGC
GCAGGAACAAGCGTCGCATCATGCCTCTTTGACCCACAGCTGCGGAAAACGTACTGGTGCAAAACG
CAGGGTTATGATCATCAGCCCAACGACGCACAGCGCATGAAATGCCCAGTCCATCAGGTAATTGCC
GCTGATACTACGCAGCACGCCAGAAAACCACGGGGCAAGCCCGGCGATGATAAAACCGATTCCCTG
CATAAACGCCACCAGCTTGCCAGCAATAGCCGGTTGCACAGAGTGATCGAGCGCCAGCAGCAAACA
GAGCGGAAACGCGCCGCCCAGACCTAACCCACACACCATCGCCCACAATACCGGCAATTGCATCGG
CAGCCAGATAAAGCCGCAGAACCCCACCAGTTGTAACACCAGCGCCAGCATTAACAGTTTGCGCCG
ATCCTGATGGCGAGCCATAGCAGGCATCAGCAAAGCTCCTGCGGCTTGCCCAAGCGTCATCAATGC
CAGTAAGGAACCGCTGTACTGCGCGCTGGCACCAATCTCAATATAGAAAGCGGGTAACCAGGCAAT
CAGGCTGGCGTAACCGCCGTTAATCAGACCGAAGTAAACACCCAGCGTCCACGCGCGGGGAGTGAA
TACCACGCGAACCGGAGTGGTTGTTGTCTTGTGGGAAGAGGCGACCTCGCGGGCGCTTTGCCACCA
CCAGGCAAAGAGCGCAACAACGGCAGGCAGCGCCACCAGGCGAGTGTTTGATACCAGGTTTCGCTA
TGTTGAACTAACCAGGGCGTTATGGCGGCACCAAGCCCACCGCCGCCCATCAGAGCCGCGGACCAC
AGCCCCATCACCAGTGGCGTGCGCTGCTGAAACCGCCGTTTAATCACCGAAGCATCACCGCCTGAA
TGATGCCGATCCCCACCCCACCAAGCAGTGCGCTGCTAAGCAGCAGCGCACTTTGCGGGTAAAGCT
CACGCATCAATGCACCGACGGCAATCAGCAACAGACTGATGGCGACACTGCGACGTTCGCTGACAT
GCTGATGAAGCCAGCTTCCGGCCAGCGCCAGCCCGCCCATGGTAACCACCGGCAGAGCGGTCGAC